| 词条 | Alu element |
| 释义 |
An Alu element is a short stretch of DNA originally characterized by the action of the Arthrobacter luteus (Alu) restriction endonuclease.[1] Alu elements are the most abundant transposable elements, containing over one million copies dispersed throughout the human genome.[2] Alu elements are also known as selfish or parasitic genes, because their sole function is self reproduction.[3] They are derived from the small cytoplasmic 7SL RNA, a component of the signal recognition particle. Alu elements are highly conserved within primate genomes and originated in the genome of an ancestor of Supraprimates.[4] Alu insertions have been implicated in several inherited human diseases and in various forms of cancer.{{citation needed|date=December 2017}} The study of Alu elements has also been important in elucidating human population genetics and the evolution of primates, including the evolution of humans.{{citation needed|date=December 2017}} The Alu familyThe Alu family is a family of repetitive elements in primate genomes, including the human genome.[5] Modern Alu elements are about 300 base pairs long and are therefore classified as short interspersed nuclear elements (SINEs) among the class of repetitive DNA elements. The typical structure is 5' - Part A - A5TACA6 - Part B - PolyA Tail - 3', where Part A and Part B are similar nucleotide sequences. Expressed another way, it is believed modern Alu elements emerged from a head to tail fusion of two distinct FAMs (fossil antique monomers) over 100 mya, hence its dimeric structure of two similar, but distinct monomers (left and right arms) joined by an A-rich linker.[6] The length of the polyA tail varies between Alu families. There are over one million Alu elements interspersed throughout the human genome, and it is estimated that about 10.7% of the human genome consists of Alu sequences. However, less than 0.5% are polymorphic (i.e. they occur in more than one form or morph).[7] In 1988, Jerzy Jurka and Temple Smith discovered that Alu elements were split in two major subfamilies known as AluJ (named after Jurka) and AluS (named after Smith), and other Alu subfamilies were also independently discovered by several groups.[8] Later on, a sub-subfamily of AluS which included active Alu elements was given the separate name AluY. Dating back 65 million years, the AluJ lineage is the oldest and least active in the human genome. The younger AluS lineage is about 30 million years old and still contains some active elements. Finally, the AluY elements are the youngest of the three and have the greatest disposition to move along the human genome.[9] The discovery of Alu subfamilies led to the hypothesis of master/source genes, and provided the definitive link between transposable elements (active elements) and interspersed repetitive DNA (mutated copies of active elements).[10] 7SL RNAThe functional retinoic acid response element hexamer sites[11] are in upper case and overlap the internal transcriptional promoter. An example of a human Alu monomer, 153 basepairs long, derived from 7SL RNA: GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCagctACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGT TCTGGGCTGTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC. The recognition sequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts the DNA segment between the guanine and cytosine residues (in lowercase above). [12] Alu elementsAlu elements are responsible for regulation of tissue-specific genes. They are also involved in the transcription of nearby genes and can sometimes change the way a gene is expressed.[13]Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs. Alu elements do not encode for protein products. They are replicated as any other DNA sequence, but depend on LINE retrotransposons for generation of new elements.[14]Alu elements replication and mobilization begins by interactions with signal recognition particles (SRPs), which aid newly translated proteins reach final destinations.[15] Alu RNA forms a specific RNA:protein complex with a protein heterodimer consisting of SRP9 and SRP14.[15] SRP9/14 facilitates AluMost human Alu element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans.[17] Impact of Alu in humansAlu elements have been proposed to affect gene expression and been found to contain functional promoter regions for steroid hormone receptors.[11][18] Due to the abundant content of CpG dinucleotides found in Alu elements, these regions serve as a site of methylation, contributing to up to 30% of the methylation sites in the human genome.[19] Alu elements are also a common source of mutations in humans, however, such mutations are often confined to non-coding regions of pre-mRNA (introns), where they have little discernible impact on the bearer.[20] Mutations in the introns (or non-coding regions of RNA) have little or no effect on phenotype of an individual if the coding portion of individual's genome does not contain mutations. The Alu insertions that can be detrimental to the human body are inserted into coding regions (exons) or into mRNA after the process of splicing.[21]However, the variation generated can be used in studies of the movement and ancestry of human populations,[22] and the mutagenic effect of Alu[23] and retrotransposons in general[24] has played a major role in the recent evolution of the human genome.{{citation needed|date=December 2017}} There are also a number of cases where Alu insertions or deletions are associated with specific effects in humans: Associations with human diseaseAlu insertions are sometimes disruptive and can result in inherited disorders. However, most Alu variation acts as markers that segregate with the disease so the presence of a particular Alu allele does not mean that the carrier will definitely get the disease. The first report of Alu-mediated recombination causing a prevalent inherited predisposition to cancer was a 1995 report about hereditary nonpolyposis colorectal cancer.[25] In the human genome, the most recently active have been the 22 AluY and 6 AluS Transposon Element subfamilies due to their inherited activity to cause various cancers. Thus due to their major heritable damage it is important to understand the causes that affect their transpositional activity.[26]The following human diseases have been linked with Alu insertions:[22][27]
And the following diseases have been associated with single-nucleotide DNA variations in Alu elements affecting transcription levels:[28]
Other Alu-associated human mutations
References1. ^{{cite journal |doi=10.1016/0092-8674(75)90184-1 |pmid=1052772 |title=Sequence organization of the human genome |journal=Cell |volume=6 |issue=3 |pages=345–58 |year=1975 |last1=Schmid |first1=Carl W |last2=Deininger |first2=Prescott L }} 2. ^{{cite journal |doi=10.1002/elps.1150190806 |pmid=9694261 |title=Effects of Alu insertions on gene function |journal=Electrophoresis |volume=19 |issue=8–9 |pages=1260–4 |year=1998 |last1=Szmulewicz |first1=Martin N |last2=Novick |first2=Gabriel E |last3=Herrera |first3=Rene J }} 3. ^{{cite journal |doi=10.1554/0014-3820(2001)055[0001:ptepda]2.0.co;2 |pmid=11263730 |title=Perspective: Transposable Elements, Parasitic Dna, and Genome Evolution |journal=Evolution |volume=55 |issue=1 |pages=1–24 |year=2001 |last1=Kidwell |first1=Margaret G |last2=Lisch |first2=Damon R }} 4. ^{{cite journal |doi=10.1016/j.tig.2007.02.002 |pmid=17307271 |title=Evolutionary history of 7SL RNA-derived SINEs in Supraprimates |journal=Trends in Genetics |volume=23 |issue=4 |pages=158–61 |year=2007 |last1=Kriegs |first1=Jan Ole |last2=Churakov |first2=Gennady |last3=Jurka |first3=Jerzy |last4=Brosius |first4=Jürgen |last5=Schmitz |first5=Jürgen }} 5. ^{{Cite journal|last=Arcot|first=Santosh S.|last2=Wang|first2=Zhenyuan|last3=Weber|first3=James L.|last4=Deininger|first4=Prescott L.|last5=Batzer|first5=Mark A.|date=September 1995|title=Alu Repeats: A Source for the Genesis of Primate Microsatellites|journal=Genomics|volume=29|issue=1|pages=136–144|doi=10.1006/geno.1995.1224|issn=0888-7543}} 6. ^{{cite journal |doi=10.1093/nar/gkl706 |pmid=17020921 |pmc=1636486 |title=Alu elements as regulators of gene expression |journal=Nucleic Acids Research |volume=34 |issue=19 |pages=5491–7 |year=2006 |last1=Häsler |first1=Julien |last2=Strub |first2=Katharina }} 7. ^{{cite journal |pmid=11560904 |pmc=1461783 |year=2001 |author1=Roy-Engel |first1=A. M |title=Alu insertion polymorphisms for the study of human genomic diversity |journal=Genetics |volume=159 |issue=1 |pages=279–90 |last2=Carroll |first2=M. L |last3=Vogel |first3=E |last4=Garber |first4=R. K |last5=Nguyen |first5=S. V |last6=Salem |first6=A. H |last7=Batzer |first7=M. A |last8=Deininger |first8=P. L }} 8. ^{{cite journal |doi=10.1073/pnas.85.13.4775 |pmid=3387438 |pmc=280518 |title=A fundamental division in the Alu family of repeated sequences |journal=Proceedings of the National Academy of Sciences |volume=85 |issue=13 |pages=4775–8 |year=1988 |last1=Jurka |first1=J |last2=Smith |first2=T |bibcode=1988PNAS...85.4775J }} 9. ^1 {{cite journal |doi=10.1101/gr.081737.108 |pmid=18836035 |pmc=2593586 |title=Active Alu retrotransposons in the human genome |journal=Genome Research |volume=18 |issue=12 |pages=1875–83 |year=2008 |last1=Bennett |first1=E. A |last2=Keller |first2=H |last3=Mills |first3=R. E |last4=Schmidt |first4=S |last5=Moran |first5=J. V |last6=Weichenrieder |first6=O |last7=Devine |first7=S. E }} 10. ^{{cite journal |doi=10.1007/bf02102862 |pmid=1774786 |title=Evolution of the master Alu gene(s) |journal=Journal of Molecular Evolution |volume=33 |issue=4 |pages=311–20 |year=1991 |last1=Richard Shen |first1=M |last2=Batzer |first2=Mark A |last3=Deininger |first3=Prescott L |bibcode=1991JMolE..33..311R }} 11. ^1 {{cite journal |doi=10.1073/pnas.92.18.8229 |pmid=7667273 |pmc=41130 |title=The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element |journal=Proceedings of the National Academy of Sciences |volume=92 |issue=18 |pages=8229–33 |year=1995 |last1=Vansant |first1=G |last2=Reynolds |first2=W. F |bibcode=1995PNAS...92.8229V }} 12. ^{{cite journal | journal=Nature | date=1984 | volume=312 |issue=5990 | pages=171–2 | title=Alu sequences are processed 7SL RNA genes | author=Ullu E, Tschudi C | pmid= 6209580| doi=10.1038/312171a0 }} 13. ^{{cite journal |pmid=8790336 |pmc=38434 |year=1996 |author1=Britten |first1=R. J |title=DNA sequence insertion and evolutionary variation in gene regulation |journal=Proceedings of the National Academy of Sciences of the United States of America |volume=93 |issue=18 |pages=9374–7 |doi=10.1073/pnas.93.18.9374|bibcode=1996PNAS...93.9374B }} 14. ^{{cite journal |doi=10.1016/S0074-7696(05)47004-7 |pmid=16344113 |title=Short Retroposons in Eukaryotic Genomes |journal=International Review of Cytology |volume=247 |pages=165–221 |year=2005 |last1=Kramerov |first1=D |last2=Vassetzky |first2=N }} 15. ^1 {{cite journal |doi=10.1038/35041507 |pmid=11089964 |title=Structure and assembly of the Alu domain of the mammalian signal recognition particle |journal=Nature |volume=408 |issue=6809 |pages=167–73 |year=2000 |last1=Weichenrieder |first1=Oliver |last2=Wild |first2=Klemens |last3=Strub |first3=Katharina |last4=Cusack |first4=Stephen |bibcode=2000Natur.408..167W }} 16. ^{{Cite journal|last=Terreros|first=Maria C.|last2=Alfonso-Sanchez|first2=Miguel A.|last3=Novick|last4=Luis|last5=Lacau|last6=Lowery|last7=Regueiro|last8=Herrera|date=September 11, 2009|title=Insights on human evolution: an analysis of Alu insertion polymorphisms|journal=Journal of Human Genetics|volume=54|issue=10|pages=603–611|doi=10.1038/jhg.2009.86|pmid=19745832}} 17. ^{{cite journal |doi=10.1038/nature04072 |pmid=16136131 |title=Initial sequence of the chimpanzee genome and comparison with the human genome |journal=Nature |volume=437 |issue=7055 |pages=69–87 |year=2005 |bibcode=2005Natur.437...69. |author1=Chimpanzee Sequencing Analysis Consortium }} 18. ^{{cite journal |pmid=7559405 |year=1995 |author1=Norris |first1=J |title=Identification of a new subclass of Alu DNA repeats that can function as estrogen receptor-dependent transcriptional enhancers |journal=The Journal of Biological Chemistry |volume=270 |issue=39 |pages=22777–82 |last2=Fan |first2=D |last3=Aleman |first3=C |last4=Marks |first4=J. R |last5=Futreal |first5=P. A |last6=Wiseman |first6=R. W |last7=Iglehart |first7=J. D |last8=Deininger |first8=P. L |last9=McDonnell |first9=D. P |doi=10.1074/jbc.270.39.22777}} 19. ^{{cite journal |doi=10.1093/nar/26.20.4541 |pmid=9753719 |pmc=147893 |title=Does SINE evolution preclude Alu function? |journal=Nucleic Acids Research |volume=26 |issue=20 |pages=4541–50 |year=1998 |last1=Schmid |first1=C. W }} 20. ^{{cite journal |doi=10.1038/35057062 |pmid=11237011 |title=Initial sequencing and analysis of the human genome |journal=Nature |volume=409 |issue=6822 |pages=860–921 |year=2001 |last1=Lander |first1=Eric S |last2=Linton |first2=Lauren M |last3=Birren |first3=Bruce |last4=Nusbaum |first4=Chad |last5=Zody |first5=Michael C |last6=Baldwin |first6=Jennifer |last7=Devon |first7=Keri |last8=Dewar |first8=Ken |last9=Doyle |first9=Michael |last10=Fitzhugh |first10=William |last11=Funke |first11=Roel |last12=Gage |first12=Diane |last13=Harris |first13=Katrina |last14=Heaford |first14=Andrew |last15=Howland |first15=John |last16=Kann |first16=Lisa |last17=Lehoczky |first17=Jessica |last18=Levine |first18=Rosie |last19=McEwan |first19=Paul |last20=McKernan |first20=Kevin |last21=Meldrim |first21=James |last22=Mesirov |first22=Jill P |last23=Miranda |first23=Cher |last24=Morris |first24=William |last25=Naylor |first25=Jerome |last26=Raymond |first26=Christina |last27=Rosetti |first27=Mark |last28=Santos |first28=Ralph |last29=Sheridan |first29=Andrew |last30=Sougnez |first30=Carrie |display-authors=29 |bibcode=2001Natur.409..860L }} 21. ^{{cite journal |doi=10.1006/mgme.1999.2864 |pmid=10381326 |title=Alu Repeats and Human Disease |journal=Molecular Genetics and Metabolism |volume=67 |issue=3 |pages=183–93 |year=1999 |last1=Deininger |first1=Prescott L |last2=Batzer |first2=Mark A }} 22. ^1 {{cite journal |doi=10.1038/nrg798 |pmid=11988762 |title=Alu Repeats and Human Genomic Diversity |journal=Nature Reviews Genetics |volume=3 |issue=5 |pages=370–9 |year=2002 |last1=Batzer |first1=Mark A |last2=Deininger |first2=Prescott L }} 23. ^{{cite journal |doi=10.1073/pnas.1012834108 |pmid=21282640 |pmc=3041063 |title=Widespread establishment and regulatory impact of Alu exons in human genes |journal=Proceedings of the National Academy of Sciences |volume=108 |issue=7 |pages=2837–42 |year=2011 |last1=Shen |first1=S |last2=Lin |first2=L |last3=Cai |first3=J. J |last4=Jiang |first4=P |last5=Kenkel |first5=E. J |last6=Stroik |first6=M. R |last7=Sato |first7=S |last8=Davidson |first8=B. L |last9=Xing |first9=Y |bibcode=2011PNAS..108.2837S }} 24. ^{{cite journal |doi=10.1038/nrg2640 |pmid=19763152 |pmc=2884099 |title=The impact of retrotransposons on human genome evolution |journal=Nature Reviews Genetics |volume=10 |issue=10 |pages=691–703 |year=2009 |last1=Cordaux |first1=Richard |last2=Batzer |first2=Mark A }} 25. ^{{cite journal |doi=10.1038/nm1195-1203 |pmid=7584997 |title=Founding mutations and Alu-mediated recombination in hereditary colon cancer |journal=Nature Medicine |volume=1 |issue=11 |pages=1203–6 |year=1995 |last1=Nyström-Lahti |first1=Minna |last2=Kristo |first2=Paula |last3=Nicolaides |first3=Nicholas C |last4=Chang |first4=Sheng-Yung |last5=Aaltonen |first5=Lauri A |last6=Moisio |first6=Anu-Liisa |last7=Järvinen |first7=Heikki J |last8=Mecklin |first8=Jukka-Pekka |last9=Kinzler |first9=Kenneth W |last10=Vogelstein |first10=Bert |last11=de la Chapelle |first11=Albert |last12=Peltomäki |first12=Päivi }} 26. ^{{cite journal |doi=10.1186/s12864-017-4227-z |pmid=29219079 |pmc=5773891 |title=Computational identification of harmful mutation regions to the activity of transposable elements |journal=BMC Genomics |volume=18 |issue=Suppl 9 |pages=862 |year=2017 |last1=Jin |first1=Lingling |last2=McQuillan |first2=Ian |last3=Li |first3=Longhai }} 27. ^{{cite journal |doi=10.1186/gb-2011-12-12-236 |pmid=22204421 |pmc=3334610 |title=Alu elements: Know the SINEs |journal=Genome Biology |volume=12 |issue=12 |pages=236 |year=2011 |last1=Deininger |first1=Prescott }} 28. ^{{cite web |url=http://www.snpedia.com/index.php/Rs2333227 |work=SNPedia |title=SNP in the promoter region of the myeloperoxidase MPO gene }}{{MEDRS|date=December 2017}} 29. ^{{cite journal |doi=10.2165/11588720-000000000-00000 |pmid=21615186 |title=The ACE Gene and Human Performance |journal=Sports Medicine |volume=41 |issue=6 |pages=433–48 |year=2011 |last1=Puthucheary |first1=Zudin |last2=Skipworth |first2=James R.A |last3=Rawal |first3=Jai |last4=Loosemore |first4=Mike |last5=Van Someren |first5=Ken |last6=Montgomery |first6=Hugh E }} 30. ^{{cite journal |pmid=10413401 |url=http://genome.cshlp.org/cgi/pmidlookup?view=long&pmid=10413401 |year=1999 |author1=Dulai |first1=K. S |title=The evolution of trichromatic color vision by opsin gene duplication in New World and Old World primates |journal=Genome Research |volume=9 |issue=7 |pages=629–38 |last2=von Dornum |first2=M |last3=Mollon |first3=J. D |last4=Hunt |first4=D. M |doi=10.1101/gr.9.7.629|doi-broken-date=2019-02-17 }} External links
2 : Repetitive DNA sequences|Human genetics |
| 随便看 |
|
开放百科全书收录14589846条英语、德语、日语等多语种百科知识，基本涵盖了大多数领域的百科知识，是一部内容自由、开放的电子版国际百科全书。